This lesson is still being designed and assembled (Pre-Alpha version)

previous episode

Introduction to Bioinformatics workflows with Nextflow and nf-core

next episode

Processes

Overview

Teaching: 30 min
Exercises: 15 min
Questions

  • How do I run tasks/processes in Nextflow?

  • How do I get data, files and values, into a processes?

Objectives

  • Understand how Nextflow uses processes to execute tasks.

  • Create a Nextflow process.

  • Define inputs to a process.

Processes

We now know how to create and use Channels to send data around a workflow. We will now see how to run tasks within a workflow using processes.

A process is the way Nextflow executes commands you would run on the command line or custom scripts.

A process can be thought of as a particular step in a workflow, e.g. an alignment step in RNA-seq analysis. Processes are independent of each other (don’t require any another process to execute) and can not communicate/write to each other. Data is passed between processes via input and output Channels.

For example, below is the command you would run to count the number of sequence records in a FASTA format file such as the yeast transcriptome:

FASTA format

FASTA format is a text-based format for representing either nucleotide sequences or peptide sequences. A sequence in FASTA format begins with a single-line description, followed by lines of sequence data. The description line is distinguished from the sequence data by a greater-than (“>”) symbol in the first column.

 >YBR024W_mRNA cdna chromosome:R64-1-1:II:289445:290350:1 gene:YBR024W gene_biotype:protein_coding transcript_biotype:protein_coding gene_symbol:SCO2 description:Protein anchored to mitochondrial inner membrane; may have a redundant function with Sco1p in delivery of copper to cytochrome c oxidase; interacts with Cox2p; SCO2 has a paralog, SCO1, that arose from the whole genome duplication [Source:SGD;Acc:S000000228]
ATGTTGAATAGTTCAAGAAAATATGCTTGTCGTTCCCTATTCAGACAAGCGAACGTCTCA
ATAAAAGGACTCTTTTATAATGGAGGCGCATATCGAAGAGGGTTTTCAACGGGATGTTGT

$ zgrep -c '^>' data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz

6612

Now we will show how to convert this into a simple Nextflow process.

Process definition

The process definition starts with keyword process, followed by process name, in this case NUMSEQ, and finally the process body delimited by curly brackets {}. The process body must contain a string which represents the command or, more generally, a script that is executed by it.

process NUMSEQ {
  script:
  "zgrep -c '^>' ${projectDir}/data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz"
}

This process would run once.

Implicit variables

We use the Nextflow implicit variable ${projectDir} to specify the directory where the main script is located. This is important as Nextflow scripts are executed in a separate working directory. A full list of implicit variables can be found here

To add the process to a workflow add a workflow block, and call the process like a function. We will learn more about the workflow block in the workflow episode.

Note: As we are using DSL2 we need to include nextflow.enable.dsl=2 in the script.

//process_01.nf
nextflow.enable.dsl=2

process NUMSEQ {
  script:
  "zgrep -c '^>' ${projectDir}/data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz"
}

workflow {
  //process is called like a function in the workflow block
  NUMSEQ()
}

We can now run the process:

$ nextflow run process_01.nf -process.echo

N E X T F L O W  ~  version 21.10.6
Launching `process_01.nf` [modest_pike] - revision: 3eaa812b17
executor >  local (1)
[cd/eab1fd] process > NUMSEQ [100%] 1 of 1 ✔
6612

A Simple Process

Create a Nextflow script simple_process.nf that has one process COUNT_BASES that runs the command.

zgrep -v '^>' ${projectDir}/data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz|tr -d '\n'|wc -m

Solution

nextflow.enable.dsl=2

process COUNT_BASES {
   
  script:
  """
  zgrep -v '^>' ${projectDir}/data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz|tr -d '\n'|wc -m
  """
}

workflow {
  COUNT_BASES()
}

Note We need to add the Nextflow run option -process.echo to print the output to the terminal.

$ nextflow run simple_process.nf -process.echo

N E X T F L O W  ~  version 21.04.0
Launching `simple_process.nf`` [prickly_gilbert] - revision: 471a79c65c
executor >  local (1)
[56/5e6001] process > COUNT_BASES [100%] 1 of 1 ✔
8772368

Definition blocks

The previous example was a simple process with no defined inputs and outputs that ran only once. To control inputs, outputs and how a command is executed a process may contain five definition blocks:

  1. directives - 0, 1, or more: allow the definition of optional settings that affect the execution of the current process e.g. the number of cpus a task uses and the amount of memory allocated.
  2. inputs - 0, 1, or more: Define the input dependencies, usually channels, which determines the number of times a process is executed.
  3. outputs - 0, 1, or more: Defines the output channels used by the process to send results/data produced by the process.
  4. when clause - optional: Allows you to define a condition that must be verified in order to execute the process.
  5. script block - required: A statement within quotes that defines the commands that are executed by the process to carry out its task.

The syntax is defined as follows:

process < NAME > {
  [ directives ]        
  input:                
  < process inputs >
  output:               
  < process outputs >
  when:                 
  < condition >
  [script|shell|exec]:  
  < user script to be executed >
}

Script

At minimum a process block must contain a script block.

The script block is a String “statement” that defines the command that is executed by the process to carry out its task. These are normally the commands you would run on a terminal.

A process contains only one script block, and it must be the last statement when the process contains input and output declarations.

The script block can be a simple one line string in quotes e.g.

nextflow.enable.dsl=2

process NUMSEQ {
    script:
    "zgrep -c '^>' ${projectDir}/data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz"
}

workflow {
  NUMSEQ()
}

Or, for commands that span multiple lines you can encase the command in triple quotes """.

For example:

//process_multi_line.nf
nextflow.enable.dsl=2

process NUMSEQ_CHR {
    script:
    """
    zgrep  '^>' ${projectDir}/data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz > ids.txt
    zgrep -c '>YA' ids.txt
    """
}

workflow {
  NUMSEQ_CHR()
}

$ nextflow run process_multi_line.nf -process.echo

N E X T F L O W  ~  version 21.10.6
Launching `process_multi_line.nf` [focused_jang] - revision: e32caf0dcb
executor >  local (1)
[00/14ce67] process > CHR_COUNT (1) [100%] 1 of 1 ✔
Number of sequences for chromosome A:118

By default the process command is interpreted as a Bash script. However, any other scripting language can be used just simply starting the script with the corresponding Shebang declaration. For example:

//process_python.nf
nextflow.enable.dsl=2

process PYSTUFF {
  script:
  """
  #!/usr/bin/env python
  import gzip

  reads = 0
  bases = 0

  with gzip.open('${projectDir}/data/yeast/reads/ref1_1.fq.gz', 'rb') as read:
      for id in read:
          seq = next(read)
          reads += 1
          bases += len(seq.strip())
          next(read)
          next(read)

  print("reads", reads)
  print("bases", bases)
  """
}

workflow {
  PYSTUFF()
}

//process_rscript.nf
nextflow.enable.dsl=2

process RSTUFF {
  script:
  """
  #!/usr/bin/env Rscript
  library("ShortRead")
  countFastq(dirPath="data/yeast/reads/ref1_1.fq.gz")
  """
}

workflow {
  RSTUFF()
}

This allows the use of a different programming languages which may better fit a particular job. However, for large chunks of code it is suggested to save them into separate files and invoke them from the process script.

nextflow.enable.dsl=2

process PYSTUFF {

  script:
  """
  myscript.py
  """
}

workflow {
  PYSTUFF()
}

Associated scripts

Scripts such as the one in the example above, myscript.py, can be stored in a bin folder at the same directory level as the Nextflow workflow script that invokes them, and given execute permission. Nextflow will automatically add this folder to the PATH environment variable. To invoke the script in a Nextflow process, simply use its filename on its own rather than invoking the interpreter e.g. myscript.py instead of python myscript.py.

Script parameters

The command in the script block can be defined dynamically using Nextflow variables e.g. ${projectDir}. To reference a variable in the script block you can use the $ in front of the Nextflow variable name, and additionally you can add {} around the variable name e.g. ${projectDir}.

Variable substitutions

Similar to bash scripting Nextflow uses the “$” character to introduce variable substitutions. The variable name to be expanded may be enclosed in braces {variable_name}, which are optional but serve to protect the variable to be expanded from characters immediately following it which could be interpreted as part of the name. It is a good rule of thumb to always use the {} syntax.

In the example below the variable chr is set to the value A at the top of the Nextflow script. The variable is referenced using the $chr syntax within the multi-line string statement in the script block. A Nextflow variable can be used multiple times in the script block.

//process_script.nf
nextflow.enable.dsl=2

chr = "A"

process CHR_COUNT {

  script:
  """
  printf "Number of sequences for chromosome ${chr} :"
  zgrep -c '>Y'${chr} ${projectDir}/data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz
  """
}

workflow {
  CHR_COUNT()
}

In most cases we do not want to hard code parameter values. We saw in the parameter episode the use of a special Nextflow variable params that can be used to assign values from the command line. You would do this by adding a key name to the params variable and specifying a value, like params.keyname = value

In the example below we define the variable params.chr with a default value of A in the Nextflow script.

//process_script_params.nf
nextflow.enable.dsl=2

params.chr = "A"

process CHR_COUNT {

  script:
  """
  printf  'Number of sequences for chromosome '${params.chr}':'
  zgrep  -c '^>Y'${params.chr} ${projectDir}/data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz
  """
}

workflow {
  CHR_COUNT()
}

Remember, we can change the default value of chr to a different value such as B, by running the Nextflow script using the command below. Note: parameters to the workflow have two hyphens --.

nextflow run process_script_params.nf --chr B

Script parameters

For the Nextflow script below.

//process_exercise_script_params.nf
nextflow.enable.dsl=2

process COUNT_BASES {

 script:
 """
 zgrep -v  '^>'   ${projectDir}/data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz|grep -o A|wc -l   
 """
}

workflow {
  COUNT_BASES()
}

Add a parameter params.base to the script and uses the variable ${param.base} insides the script. Run the pipeline using a base value of C using the --base command line option.

$ nextflow run process_script_params.nf --base <some value> -process.echo

Note: The Nextflow option -process.echo will print the process’ stdout to the terminal.

Solution

//process_exercise_script_params.nf
nextflow.enable.dsl=2

params.base='A'

process COUNT_BASES {
 
script:
 """
 zgrep -v  '^>'   ${projectDir}/data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz|grep -o ${params.base}|wc -l   
 """
}

workflow {
  COUNT_BASES()
}

nextflow run process_script_params.nf --base C -process.echo

N E X T F L O W  ~  version 21.04.0
Launching `process_script_params.nf ` [nostalgic_jones] - revision: 9feb8de4fe
executor >  local (1)
[92/cdc9de] process > COUNT_BASES [100%] 1 of 1 ✔
 1677188

Bash variables

Nextflow uses the same Bash syntax for variable substitutions, $variable, in strings. However, Bash variables need to be escaped using \ character in front of \$variable name.

In the example below we will set a bash variable NUMIDS then echo the value of NUMIDS in our script block.

nextflow.enable.dsl=2

process NUM_IDS {

  script:
  """
  #set bash variable NUMIDS
  NUMIDS=`zgrep -c '^>' $params.transcriptome`

  echo 'Number of sequences'
  printf "%'d\n" \$NUMIDS
  """
}

params.transcriptome = "${projectDir}/data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz"

workflow {
  NUM_IDS()
}

Shell

Another alternative is to use a shell block definition instead of script. When using the shell statement Bash variables are referenced in the normal way $my_bash_variable; However, the shell statement uses a different syntax for Nextflow variable substitutions: !{nextflow_variable}, which is needed to use both Nextflow and Bash variables in the same script.

For example in the script below that uses the shell statement we reference the Nextflow variables as !{projectDir} , and the Bash variable as ${NUMCHAR} and ${NUMLINES}.

//process_shell.nf
nextflow.enable.dsl=2

process NUM_IDS {

  shell:
  //Shell script definition requires the use of single-quote ' delimited strings
  '''
  #set bash variable NUMIDS
  NUMIDS=`zgrep -c '^>' !{params.transcriptome}`

  echo 'Number of sequences'
  printf  $NUMIDS
  '''
}

params.transcriptome = "${projectDir}/data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz"

workflow {
  NUM_IDS()
}

Conditional script execution

Sometimes you want to change how a process is run depending on some condition. In Nextflow scripts we can use conditional statements such as the if statement or any other expression evaluating to boolean value true or false.

If statement

The if statement uses the same syntax common to other programming languages such Java, C, JavaScript, etc.

if( < boolean expression > ) {
    // true branch
}
else if ( < boolean expression > ) {
    // true branch
}
else {
    // false branch
}

For example, the Nextflow script below will use the if statement to change what the COUNT process counts depending on the Nextflow variable params.method.

//process_conditional.nf
nextflow.enable.dsl=2

params.method = 'ids'
params.transcriptome = "$projectDir/data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz"


process COUNT {
  script:
  if( params.method == 'ids' ) {
    """
    echo Number of sequences in transciptome
    zgrep -c "^>" $params.transcriptome
    """
  }  
  else if( params.method == 'bases' ) {
    """
    echo Number of bases in transciptome
    zgrep -v "^>" $params.transcriptome|grep -o "."|wc -l
    """
  }  
  else {
    """
    echo Unknown method $params.method
    """
  }  
}

workflow {
  COUNT()
}

nextflow run process_conditional.nf -process.echo --method ids

N E X T F L O W  ~  version 21.04.0
Launching `juggle_processes.nf` [cheeky_shirley] - revision: 588f20ae5a
[01/60b08d] process > COUNT [100%] 1 of 1 ✔
Number of sequences in transciptome
6612

Inputs

Processes are isolated from each other but can communicate by sending values and files via Nextflow channels from input and into output blocks.

The input block defines which channels the process is expecting to receive input from. The number of elements in input channels determines the process dependencies and the number of times a process executes.

Process Flow

You can only define one input block at a time and it must contain one or more input declarations.

The input block follows the syntax shown below:

input:
  <input qualifier> <input name>

The input qualifier declares the type of data to be received.

Input qualifiers

  • val: Lets you access the received input value by its name as a variable in the process script.
  • env: Lets you use the input value to set an environment variable named as the specified input name.
  • path: Lets you handle the received value as a file, staging the file properly in the execution context.
  • stdin: Lets you forward the received value to the process stdin special file.
  • tuple: Lets you handle a group of input values having one of the above qualifiers.
  • each: Lets you execute the process for each entry in the input collection. A complete list of inputs can be found here.

Input values

The val qualifier allows you to receive value data as input. It can be accessed in the process script by using the specified input name, as shown in the following example:

//process_input_value.nf
nextflow.enable.dsl=2

process PRINTCHR {

  input:
  val chr

  script:
  """
  echo processing chromosome $chr
  """
}

chr_ch = Channel.of( 'A' .. 'P' )

workflow {

  PRINTCHR(chr_ch)
}

$ nextflow run process_input_value.nf -process.echo

N E X T F L O W  ~  version 21.04.0
Launching `process_input_value.nf` [wise_kalman] - revision: 7f90e1bfc5
executor >  local (24)
[b1/88df3f] process > PRINTCHR (16) [100%] 24 of 24 ✔
processing chromosome C
processing chromosome L
processing chromosome A
..truncated...

In the above example the process is executed 16 times; each time a value is received from the queue channel chr_ch it is used to run the process.

Channel order

The channel guarantees that items are delivered in the same order as they have been sent, but since the process is executed in a parallel manner, there is no guarantee that they are processed in the same order as they are received.

Input files

When you need to handle files as input, you need the path qualifier. Using the path qualifier means that Nextflow will stage it in the process execution directory, and it can be accessed in the script by using the name specified in the input declaration.

The input file name can be defined dynamically by defining the input name as a Nextflow variable and referenced in the script using the $variable_name syntax.

For example, in the script below, we assign the variable name read to the input files using the path qualifier. The file is referenced using the variable substitution syntax ${read} in the script block:

//process_input_file.nf
nextflow.enable.dsl=2

process NUMLINES {
    input:
    path read

    script:
    """
    printf '${read} '
    gunzip -c ${read} | wc -l
    """
}

reads_ch = Channel.fromPath( 'data/yeast/reads/ref*.fq.gz' )

workflow {
  NUMLINES(reads_ch)
}


$ nextflow run process_input_file.nf -process.echo

[cd/77af6d] process > NUMLINES (1) [100%] 6 of 6 ✔
ref1_1.fq.gz 58708

ref3_2.fq.gz 52592

ref2_2.fq.gz 81720

ref2_1.fq.gz 81720

ref3_1.fq.gz 52592

ref1_2.fq.gz 58708

The input name can also be defined as a user-specified filename inside quotes. For example, in the script below, the name of the file is specified as 'sample.fq.gz' in the input definition and can be referenced by that name in the script block.

//process_input_file_02.nf
nextflow.enable.dsl=2

process NUMLINES {
    input:
    path 'sample.fq.gz'

    script:
    """
    printf 'sample.fq.gz '
    gunzip -c sample.fq.gz | wc -l
    """
}

reads_ch = Channel.fromPath( 'data/yeast/reads/ref*.fq.gz' )

workflow {
  NUMLINES(reads_ch)
}


$ nextflow run process_input_file_02.nf -process.echo

[d2/eb0e9d] process > NUMLINES (1) [100%] 6 of 6 ✔
sample.fq.gz 58708

sample.fq.gz 52592

sample.fq.gz 81720

sample.fq.gz 81720

sample.fq.gz 52592

sample.fq.gz 58708

File Objects as inputs

When a process declares an input file, the corresponding channel elements must be file objects, i.e. created with the path helper function from the file specific channel factories, e.g. Channel.fromPath or Channel.fromFilePairs.

Add input channel

For the script process_exercise_input.nf:

  1. Define a Channel using fromPath for the transcriptome params.transcriptome.
  2. Add an input channel that takes the transcriptome channel as a file input.
  3. Replace params.transcriptome in the script: block with the input variable you defined in the input: definition.
//process_exercise_input.nf
nextflow.enable.dsl=2

params.chr = "A"
params.transcriptome = "${projectDir}/data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz"
process CHR_COUNT {

 script:
 """
 printf  'Number of sequences for chromosome '${params.chr}':'
 zgrep  -c '^>Y'${params.chr} ${params.transcriptome}
 """
}

workflow {
 CHR_COUNT()
}

Then run your script using

nextflow run process_exercise_input.nf -process.echo

Solution

nextflow.enable.dsl=2

params.chr = "A"
params.transcriptome = "${projectDir}/data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz"> >

process CHR_COUNT {
 input:
 path transcriptome

 script:
 """
 printf  'Number of sequences for chromosome '${params.chr}':'
 zgrep  -c '^>Y'${params.chr} ${transcriptome}
 """
}

transcriptome_ch = channel.fromPath(params.transcriptome)

workflow {
 CHR_COUNT(transcriptome_ch)
}


N E X T F L O W  ~  version 21.10.6
Launching `process_exercise_input.nf` [focused_jang] - revision: e32caf0dcb
executor >  local (1)
[00/14ce67] process > CHR_COUNT (1) [100%] 1 of 1 ✔
Number of sequences for chromosome A:118

Combining input channels

A key feature of processes is the ability to handle inputs from multiple channels. However, it’s important to understand how the number of items within the multiple channels affect the execution of a process.

Consider the following example:

//process_combine.nf
nextflow.enable.dsl=2

process COMBINE {
  input:
  val x
  val y

  script:
  """
  echo $x and $y
  """
}

num_ch = Channel.of(1, 2, 3)
letters_ch = Channel.of('a', 'b', 'c')

workflow {
  COMBINE(num_ch, letters_ch)
}

$ nextflow run process_combine.nf -process.echo

Both channels contain three elements, therefore the process is executed three times, each time with a different pair:

2 and b

1 and a

3 and c

What is happening is that the process waits until it receives an input value from all the queue channels declared as input.

When this condition is verified, it uses up the input values coming from the respective queue channels, runs the task. This logic repeats until one or more queue channels have no more content. The process then stops.

What happens when not all channels have the same number of elements?

For example:

//process_combine_02.nf
nextflow.enable.dsl=2

process COMBINE {
  input:
  val x
  val y

  script:
  """
  echo $x and $y
  """
}

ch_num = Channel.of(1, 2)
ch_letters = Channel.of('a', 'b', 'c', 'd')

workflow {
  COMBINE(ch_num, ch_letters)
}

$ nextflow run process_combine_02.nf -process.echo

In the above example the process is executed only two times, because when a queue channel has no more data to be processed it stops the process execution.

2 and b

1 and a

Value channels and process termination

Note however that value channels, Channel.value, do not affect the process termination.

To better understand this behaviour compare the previous example with the following one:

//process_combine_03.nf
nextflow.enable.dsl=2

process COMBINE {
  input:
  val x
  val y

  script:
  """
  echo $x and $y
  """
}
ch_num = Channel.value(1)
ch_letters = Channel.of('a', 'b', 'c')

workflow {
  COMBINE(ch_num, ch_letters)
}

$ nextflow run process_combine_03.nf -process.echo

In this example the process is run three times.

1 and b
1 and a
1 and c

Combining input channels

Write a nextflow script process_exercise_combine.nf that combines two input channels

transcriptome_ch = channel.fromPath('data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz')
chr_ch = channel.of('A')

And include the command below in the script directive

  script:
  """
  zgrep -c ">Y${chr}" ${transcriptome}
  """

Solution

// process_exercise_combine_answer.nf
nextflow.enable.dsl=2
process COMBINE {
 input:
 path transcriptome
 val chr

 script:
 """
 zgrep -c ">Y${chr}" ${transcriptome}
 """
}

transcriptome_ch = channel.fromPath('data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz', checkIfExists: true)
chr_ch = channel.of("A")

workflow {
  COMBINE(transcriptome_ch, chr_ch)
}

Input repeaters

We saw previously that by default the number of times a process runs is defined by the queue channel with the fewest items. However, the each qualifier allows you to repeat the execution of a process for each item in a list or a queue channel, every time new data is received.

For example if we can fix the previous example by using the input qualifer each for the letters queue channel:

//process_repeat.nf
nextflow.enable.dsl=2

process COMBINE {
  input:
  val x
  each y

  script:
  """
  echo $x and $y
  """
}

ch_num = Channel.of(1, 2)
ch_letters = Channel.of('a', 'b', 'c', 'd')

workflow {
  COMBINE(ch_num, ch_letters)
}

$ nextflow run process_repeat.nf -process.echo

The process will run eight times.

2 and d
1 and a
1 and c
2 and b
2 and c
1 and d
1 and b
2 and a

Input repeaters

Extend the script process_exercise_repeat.nf by adding more values to the chr queue channel e.g. A to P and running the process for each value.

//process_exercise_repeat.nf
 nextflow.enable.dsl=2
 process COMBINE {
   input:
   path transcriptome
   val chr
  
   script:
   """
     printf "Number of sequences for chromosome $chr: "
   zgrep -c "^>Y${chr}" ${transcriptome}
   """
 }

 transcriptome_ch = channel.fromPath('data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz', checkIfExists: true)
 chr_ch = channel.of('A')

 workflow {
   COMBINE(transcriptome_ch, chr_ch)
 }

How many times does this process run?

Solution

//process_exercise_repeat_answer.nf
nextflow.enable.dsl=2

process COMBINE {
  input:
  path transcriptome
  each chr
 
  script:
  """
  printf "Number of sequences for chromosome $chr: "
  zgrep -c "^>Y${chr}" ${transcriptome}
  """
}

transcriptome_ch = channel.fromPath('data/yeast/transcriptome/Saccharomyces_cerevisiae.R64-1-1.cdna.all.fa.gz', checkIfExists: true)
chr_ch = channel.of('A'..'P')

workflow {
  COMBINE(transcriptome_ch, chr_ch)
}

nextflow run process_exercise_repeat.nf -process.echo

This process runs 16 times.

Key Points

  • A Nextflow process is an independent step in a workflow

  • Processes contain up to five definition blocks including: directives, inputs, outputs, when clause and finally a script block.

  • The script block contains the commands you would like to run.

  • A process should have a script but the other four blocks are optional

  • Inputs are defined in the input block with a type qualifier and a name.

previous episode

next episode